View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17638_low_30 (Length: 243)
Name: NF17638_low_30
Description: NF17638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17638_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 51943995 - 51943780
Alignment:
| Q |
1 |
tttcctattttgtctttgaagttactactgctctagaatttccatcggcattactttaaatcttcatccaacatcgatatattgatgttagcttccaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51943995 |
tttcctattttgtctttgaagttactactgctctagaatttccatcggcattactttaaatcttcatccaacatcgatatattgatgttagcttccaaac |
51943896 |
T |
 |
| Q |
101 |
ggtgatagatctcacgcctaagtagattcgtcactggtaagtagtgatctttacctatttagaaggtaacatatatctttttacaatttgaattttcctc |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51943895 |
ggtaatagatctcacgcctaagtagattcgtcactggtaagtagtgatctttacctatttagaaggtaacatatatctttttacaatttgaattttcctc |
51943796 |
T |
 |
| Q |
201 |
aatgtcatcatagata |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
51943795 |
aatgtcatcatagata |
51943780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University