View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17638_low_32 (Length: 240)
Name: NF17638_low_32
Description: NF17638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17638_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 6862031 - 6862250
Alignment:
| Q |
1 |
atatatattattgcatgttcgtctcacatgttaattctaaactgtatataaaaataaaaattaccctctagggtaatggtattgttgtgagatcaatatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6862031 |
atatatattattgcatgttcgtctcacatgttagctctaaactgtatataaaaataaaaattaccctctagggtaattgtattgttgtgagatcaatatt |
6862130 |
T |
 |
| Q |
101 |
aatagaaggtttatgttcagttagttagtgtgtctttaatataattttaactcacataccttagaaaagaaattaactgaactttcacattcattaagta |
200 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6862131 |
aatagaaggttcatgttc----agttagtgtgtctttaatataattttaactcacataccttagaaaagaaattaactgaactttcacattcattaagta |
6862226 |
T |
 |
| Q |
201 |
tgccaatttgcaaaagtacaatct |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6862227 |
tgccaatttgcaaaagtacaatct |
6862250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University