View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17639_high_25 (Length: 317)
Name: NF17639_high_25
Description: NF17639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17639_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 22 - 310
Target Start/End: Original strand, 42062752 - 42063040
Alignment:
| Q |
22 |
catcatcataccaatctgatcagctaagtaatgaacgtaactcagccttccgctggaagcatcccaactgaaatgaatacgaaggatgagggggagggtg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42062752 |
catcatcataccaatctgatcagctaagtaatgaacgtaactcagccttccgctggaagcatcccaactgaaatgaatacgaaagatgagggggagggtg |
42062851 |
T |
 |
| Q |
122 |
agttacttcacattaatgggaaacctatcaagggaaattttagactttgaaccaaaagaacttcgcattgcactctttcttcactttatcctcttattgc |
221 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
42062852 |
agttgcttcacaataatgggaaacctatcaagggaaattttagactttgaaccaaaagaactttgccttgcactctttcttcactttatcctcttattgc |
42062951 |
T |
 |
| Q |
222 |
tgcaaagatccctctccagtgtcaactatcactgagatatggagaatcagtactagttatgtgatccattacacaaactcattattgcc |
310 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42062952 |
tacaaagatccctctccagtgtcaactatcactgagatatggagaatcagtactagttatgtgatccattacacaaactcattattgcc |
42063040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University