View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1763_high_56 (Length: 315)
Name: NF1763_high_56
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1763_high_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 26047482 - 26047176
Alignment:
| Q |
1 |
tcttctctatttcccaatctctgccactgaaccaaaacccttaatcggagctaaccatacttcatcaagattctgctctcgataaaaaatattcaaatta |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26047482 |
tcttctccatttcccaatctctgccactgaaccaaaacccttaatcggagctaaccatacttcatcaagattctgctctcgataaaaaatattcaaatta |
26047383 |
T |
 |
| Q |
101 |
tttccannnnnnnnnnnnnnnnnngttatatatgaaaaagaagtgcacggtggctacaatggaacacgccgcagcgaaacctagctctttccagaatctt |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26047382 |
tttccatttttatttttaatttttgttatatatgaaaaagaagtgcacggtggctacaatggaacacgccgcagcgaaacctagctctttccagaatctt |
26047283 |
T |
 |
| Q |
201 |
ctgatacggttacttctcaccggcgttttcgtcattgctgttcgatttgcttacgtcatctccatcgctggcgagtcctgcaatgtcgccgatttctgct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
26047282 |
ctgatacggttacttctcaccggcgttttcgtcatcgctgttcgatttgcttacgtcatctccatcgccggcgagtcttgcaatgtcgccgatttctgct |
26047183 |
T |
 |
| Q |
301 |
tcatctc |
307 |
Q |
| |
|
|| |||| |
|
|
| T |
26047182 |
tcttctc |
26047176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University