View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1763_high_61 (Length: 305)
Name: NF1763_high_61
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1763_high_61 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 15 - 153
Target Start/End: Complemental strand, 38052163 - 38052025
Alignment:
| Q |
15 |
caccattcacgcaagctttctgaagaacctgttactggttttcctttctctggaacaataccatagacaaaaccttgagctttgcatattgtcataatct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052163 |
caccattcacgcaagctttctgaagaacctgttactggttttcctttctctggaacaataccatagacaaaaccttgagctttgcatattgtcataatct |
38052064 |
T |
|
| Q |
115 |
tcatcatgtatttgagaattgaatcttgtgctcttgaca |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052063 |
tcatcatgtatttgagaattgaatcttgtgctcttgaca |
38052025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 219 - 292
Target Start/End: Complemental strand, 38051959 - 38051886
Alignment:
| Q |
219 |
cccttgagcttctgtagtaggattcggtccttccacatgcgcttcttcagctcgtcataatcgatttcttcttc |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38051959 |
cccttgagcttctgtagtaggattcggtccttccacatgcgcttcttcagctcgtcataatcgatttcttcttc |
38051886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University