View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1763_high_69 (Length: 284)
Name: NF1763_high_69
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1763_high_69 |
 | |
|
| [»] scaffold0246 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0246 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 16 - 270
Target Start/End: Original strand, 5379 - 5633
Alignment:
| Q |
16 |
aaaattgaggggtgttggtagcaggtgaatttgggaggttgtcaaaagacaaaatctgagagtgcaaagatgagttagatgatgatggagaaagttttgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5379 |
aaaattgaggggtgttggtagcaggtgaatttgggaggttgtcaaaagacaaaatctgagagtgcaaagatgagttagatgatgatggagaaagttttgg |
5478 |
T |
|
| Q |
116 |
tgaaatggtttcaatgatgctgttgtcactaaaaattgtgttcagctccatgattggtctctcaatttcaaaaccaaagtcaaaagagtcaaaagttgtt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
5479 |
tgaaatggtttcaatgatgctgttgtcactaaagattgtgttcagctccatggttggtctctcaatttcaaaatcaaagtcaaaagagtcaaaatttgtt |
5578 |
T |
|
| Q |
216 |
tcatcagtgaatgagttggtgaaagttgtggaattggactctgaactcaaacatt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5579 |
tcatcagtgaatgagttggtgaaagttgtggaattggactctgaactcaaacatt |
5633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University