View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1763_high_78 (Length: 265)
Name: NF1763_high_78
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1763_high_78 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 3 - 250
Target Start/End: Original strand, 34332929 - 34333177
Alignment:
| Q |
3 |
caaaggatcagaagcagagtgagatcgcttnnnnnnnnn-caaaggaacagaaagtgagatatatggaaatggaaataatatcaagagaatttatcaaac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34332929 |
caaaggatcagaagcagagtgagatcgcttaaaaaaaaaacaaaggaacagaaagtgagatatatggaaatggaaataatatcaagagaatttatcaaac |
34333028 |
T |
|
| Q |
102 |
cctcatcaccaactccatcccaccttagaaatttccctatctctttcatagatcacatttctttccgtaactatgtgcccctacttttcttctacgatga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34333029 |
cctcatcaccaactccatcccaccttagaaatttccctatctctttcatagatcacatttctttccgtaactatgtgcccctacttttcttctacgatga |
34333128 |
T |
|
| Q |
202 |
taccaaagtttgtgaccaaacatccaaaatctcacacctcaagaattct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34333129 |
taccaaagtttgtgaccaaacatccaaaatctcacacctcaagaattct |
34333177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University