View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1763_high_95 (Length: 236)
Name: NF1763_high_95
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1763_high_95 |
 | |
|
| [»] scaffold0219 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0219 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 86 - 220
Target Start/End: Complemental strand, 9654 - 9520
Alignment:
| Q |
86 |
tatgccaattttagtttcgatccccaaaataactgattttgccaattaattcatttaggtggacaaatttagtgcaaagtttgatgctgctggaagcaat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9654 |
tatgccaattttagtttcgatccccaaaataactgattttgccaattaattcatttaggtggacaaatttagtgcaaagtttgatgctgctggaagcaat |
9555 |
T |
|
| Q |
186 |
ggtcatcacttgttgtgctttcaagaactttgtag |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9554 |
ggtcatcacttgttgtgctttcaagaactttgtag |
9520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 33 - 84
Target Start/End: Complemental strand, 10288 - 10235
Alignment:
| Q |
33 |
accttgcgaagaagttgtttccatggcaaatat--gaggtacgcacgatgccga |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10288 |
accttgcgaagaagttgtttccatggcaaatatgagaggtacgcacgatgccga |
10235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University