View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1763_high_96 (Length: 235)
Name: NF1763_high_96
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1763_high_96 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 33 - 220
Target Start/End: Complemental strand, 54306701 - 54306515
Alignment:
| Q |
33 |
aagttcttatagtacctgaataaaggaaaggtggttcgcatgacacagtaatagctgtgctcaatcataaatgacggtgacagggatggatgaggatatt |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54306701 |
aagttcttatagtacctgaataaaggaaaggtgcttcgcatgacacagtaatagctgtgctcaatcataaatgacggtgacagggatggatgagaatatt |
54306602 |
T |
|
| Q |
133 |
tccatgttttgaaaacgagacgttgttgatcattttccattgaaatgaggtgaatccaacattatctctgggttgttgttggcttaag |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54306601 |
tccatgttttgaaaacgagacgttgttgatcattttccattgaaatgaggtgaatccaacattatctct-ggttgttgttggcttaag |
54306515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University