View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1763_low_105 (Length: 230)
Name: NF1763_low_105
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1763_low_105 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 218
Target Start/End: Complemental strand, 29369475 - 29369268
Alignment:
| Q |
11 |
tccctttccaccagtctctgctttaatgcaaacttcatcgctaccactgcaaccctgttgacaacctgagctactattctcctttgggatagaagttata |
110 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29369475 |
tccctttccatcagtctctgctttaatgcaaacttcatcgctaccactgcaaccctgttgacaacctgagctactattctcctttgagatagaagttata |
29369376 |
T |
|
| Q |
111 |
tcggctagaaaattccagatgaacctaggaacgtcattaatgtatcctggattaggtgtggaagaaggttcatctaagataacaccaacataattgctcg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29369375 |
tcggctagaaaattccagatgaacctaggaacgtcattaatgtatcctggattaggtgtggaagaaggttcatctaagataacaccaacataattgctcg |
29369276 |
T |
|
| Q |
211 |
cacaggtt |
218 |
Q |
| |
|
|||||||| |
|
|
| T |
29369275 |
cacaggtt |
29369268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University