View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1763_low_111 (Length: 224)
Name: NF1763_low_111
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1763_low_111 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 90 - 224
Target Start/End: Original strand, 36463846 - 36463980
Alignment:
| Q |
90 |
gactttacataagagctcgtaaaattgtgggagaacttgaagtcactattaacatgattccaagcttggaacaacttgtttatgaagtcatcatgtctat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36463846 |
gactttacataagagctcgtaaaattgtgggagaacttgaagtcactattaacatgattccaagcttggaaaaacttgtttatgaagtcatcatgtctat |
36463945 |
T |
 |
| Q |
190 |
gttaaaggagtttagagacagggaaagaaacctat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36463946 |
gttaaaggagtttagagacagggaaagaaacctat |
36463980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 36463093 - 36463181
Alignment:
| Q |
1 |
accatactggatctcatgccaatttcaatttccaaataactcaatcatgtcaccaaattatatatttagccctttactcacattcgtca |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36463093 |
accatactggatctcatgccaatttcaatttccaaataactcaatcatgtcaccaaattatatatttaaccctttactcacattcgtca |
36463181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University