View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1763_low_113 (Length: 222)
Name: NF1763_low_113
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1763_low_113 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 41330066 - 41330250
Alignment:
| Q |
1 |
tttttaacacttgacaaggtaacttatttattattggcaaaataagttgagctcaacatgttaacccgtttaacatgttattttaggtgggggtgttgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41330066 |
tttttaacacttgacaaggtaacttatttattattggcaaaataagttgagctcaacaggttaacccgtttaacatgttattttaggtgggggtgttgag |
41330165 |
T |
 |
| Q |
101 |
atattagatagacattatcattcaaattggtgcgtctagcttgtcctgttaacttaaaaaatctatttttccaattatttatatcacttattca |
194 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41330166 |
atattagatagacattctcattcaaattggtgc---------gtcctgttaacttaaaaaatctatttttccaattatttatatcacttattca |
41330250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University