View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1763_low_92 (Length: 244)
Name: NF1763_low_92
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1763_low_92 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 12 - 227
Target Start/End: Complemental strand, 8246622 - 8246409
Alignment:
| Q |
12 |
attattcttgttttacctctttgtatgtaagtaataaatcattgaaacttttgggtaacttaaactattgggatggatctcacataggacaaagagtaac |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| | |||| || |
|
|
| T |
8246622 |
attattattgttttacctctttgtatgtaagtaataaatcattgaaacttttgggtagcttaaactattgggatggatctcacacaggata--gagtgac |
8246525 |
T |
|
| Q |
112 |
cacgcataaaaagtgagttttcatttttcaacctaaatcttcactcgaaatatttagatattaggtatgtatgaccgagttttttcacttatatatgatg |
211 |
Q |
| |
|
||| ||||||||||||||||||| |||| || ||| ||||||| || ||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8246524 |
cacacataaaaagtgagttttcactttttaatctacatcttcattcaaaatatttagacattaggtatgtatggccgagttttttcacttatatatgata |
8246425 |
T |
|
| Q |
212 |
tttaatatatactctt |
227 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8246424 |
tttaatatatactctt |
8246409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University