View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1763_low_93 (Length: 242)
Name: NF1763_low_93
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1763_low_93 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 232
Target Start/End: Complemental strand, 33437052 - 33436837
Alignment:
| Q |
15 |
actctcttctataccattgtctaaatcggttttagtaatttatagtaacatctaatgctagatctatattaaaatcttgtccaaaaataaactaaaatat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33437052 |
actctcttctataccattgtctaaatcggtttta---atttatagtaacatctaatgctagatctatattaaaatcttgtccaaaaataaactaaaatat |
33436956 |
T |
 |
| Q |
115 |
ataatgcaacattcaatgattccgtcgta-ccataaaatcttgtctgatagcacttttcaattgtcaaaacaagaagcccacaagcgtgatagtaaactg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33436955 |
ataatgcaacattcaatgattccgtcgtacccataaaatcttgtctgataacacttttcaattgtcaaaacaagaagcccacaagcgtgatagtaaactg |
33436856 |
T |
 |
| Q |
214 |
ttggaaagatttacacgtc |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33436855 |
ttggaaagatttacacgtc |
33436837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University