View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1763_low_97 (Length: 237)
Name: NF1763_low_97
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1763_low_97 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 216
Target Start/End: Original strand, 45365611 - 45365813
Alignment:
| Q |
15 |
atgaaccaaaaggccaaagagcagcgctcaaaacggtgaacaattgctcatctcaatacaacctgaaccc-aaaatgagcccagaaactatccaccaaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45365611 |
atgaaccaaaaggccaaagagcagcgctcaaaacggtgaacaattgctcatctcaatacaacctgaaccccaaaatgagcccagaaactatccaccaaac |
45365710 |
T |
 |
| Q |
114 |
catccgaaagcaaaggaaagaaggtcacacgccaactcacaagcagaaaaccgaaaccaaataaaagacctccacaaaacctactggcactgaggcttag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45365711 |
catccgaaagcaaaggaaagaaggtcacacgccaactcacaagcagaaaaccgaaaccaaataaaagacctccacaaaacctactggcactgaggcttag |
45365810 |
T |
 |
| Q |
214 |
aaa |
216 |
Q |
| |
|
||| |
|
|
| T |
45365811 |
aaa |
45365813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University