View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1763_low_98 (Length: 237)
Name: NF1763_low_98
Description: NF1763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1763_low_98 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 29783816 - 29783596
Alignment:
| Q |
1 |
gctaaggccactatcatatagtgtgacattgagcaaaattcagaatacaaatggaattttataaccatgtaatcaatgggataagattttcaaactaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29783816 |
gctaaggccactatcatatagtgtgacattgagcacaattcagaatacaaatggaattttataaccatgtaatcaatgggataagattttcaaactaaat |
29783717 |
T |
|
| Q |
101 |
gatttgtttaaccattctttccagccactcttgctctttggagaaaccagctctgattgtggctctttgtttgattggttcacctgctttttgcatagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29783716 |
gatttgtttaaccattctttccagccactcttgctctttggagaaaccagctctgattgtggctctttgtttgattggttcacctgctttttgcatagca |
29783617 |
T |
|
| Q |
201 |
caaaattccttgcctcataag |
221 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
29783616 |
caaaattccttgcttcataag |
29783596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 84 - 207
Target Start/End: Complemental strand, 29779051 - 29778928
Alignment:
| Q |
84 |
agattttcaaactaaatgatttgtttaaccattctttccagccactcttgctctttggagaaaccagctctgattgtggctctttgtttgattggttcac |
183 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| ||||||||||| ||| ||||||||||||| |||||||||||||| ||||| ||||| ||| || |
|
|
| T |
29779051 |
agattttgaaactaaatgatttatttaaccatgatttccagccaccctttctctttggagaaatcagctctgattgtgattctttccttgataggtacat |
29778952 |
T |
|
| Q |
184 |
ctgctttttgcatagcacaaaatt |
207 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
29778951 |
ctgctttttgcacagcacaaaatt |
29778928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University