View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17640_high_23 (Length: 374)
Name: NF17640_high_23
Description: NF17640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17640_high_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 3e-45; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 240 - 364
Target Start/End: Complemental strand, 36288882 - 36288758
Alignment:
| Q |
240 |
tatattttagtgtggggttgattatatggggttagagattgccagaatatgccgccgaaaaattgactcggttagtaaaaagttgactcatacggtggat |
339 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| || ||||||||||||||||||| ||||| |
|
|
| T |
36288882 |
tatattttggtgtggggttgattatatggggttagagattgccagaatatggcgtcgaaaaattgactcggataataaaaagttgactcatacgttggat |
36288783 |
T |
|
| Q |
340 |
taaatttccacttgtaagggttcat |
364 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
36288782 |
taaatttccggttgtaagggttcat |
36288758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 16 - 108
Target Start/End: Complemental strand, 36289096 - 36289004
Alignment:
| Q |
16 |
tttgtttgtacgaggtatggttttgaggactagaatcgatctcatttgtggtggaaaattcatcacttgcggtgtacacgggaaagccaggca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36289096 |
tttgtttgtacgaggtatggttttgaggactaggatcgatctcatttgtggtggaaaattcatcacttgcggtgtacacgggaaagccaggca |
36289004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 16 - 108
Target Start/End: Complemental strand, 36300545 - 36300453
Alignment:
| Q |
16 |
tttgtttgtacgaggtatggttttgaggactagaatcgatctcatttgtggtggaaaattcatcacttgcggtgtacacgggaaagccaggca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||| || ||||||||||||| |||| ||||||||||| || ||||| |||||||||||||| |
|
|
| T |
36300545 |
tttgttggtacgaggtatggttttgaagactaggattgatctcatttgtgttggagaattcatcactacaggcgtacatgggaaagccaggca |
36300453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University