View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17640_high_29 (Length: 342)
Name: NF17640_high_29
Description: NF17640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17640_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 19 - 329
Target Start/End: Complemental strand, 7500242 - 7499932
Alignment:
| Q |
19 |
cagatgttgacgaagattgaggtggggtactccaccatgatgttggggcaaaaatggcaggtgaatgtcacgtgccgctggaaaggtggaggagatcggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500242 |
cagatgttgacgaagattgaggtggggtactccaccatgatgttggggcaaaaatggcaggtgaatgtcacgtgccgctggaaaggtggaggagatcggt |
7500143 |
T |
 |
| Q |
119 |
tgtacgtgaggattgttgagtttggaatagagcgtatgaccggagaactggggaggcaagctggcattaatctcgtgaatgcaattcaaaatggagagag |
218 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500142 |
tgtacgtgaggattgttgtgtttggaatagagcatatgaccggagaactggggaggcaagctggcattaatctcgtgaatgcaattcaaaatggagagag |
7500043 |
T |
 |
| Q |
219 |
gattatatttgattgaaaaggtttataccaattcttaaatatttcatttaaatctactaggttttcatggttagaacaattgtggtaattggattggatg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500042 |
gattatatttgattgaaaaggtttataccaatttttaaatatttcatttaaatctactaggttttcatggttagaacaattgtggtaattggattggatg |
7499943 |
T |
 |
| Q |
319 |
tgttttccttc |
329 |
Q |
| |
|
|||||| |||| |
|
|
| T |
7499942 |
tgttttacttc |
7499932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University