View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17640_high_53 (Length: 222)

Name: NF17640_high_53
Description: NF17640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17640_high_53
NF17640_high_53
[»] chr4 (1 HSPs)
chr4 (19-172)||(46767547-46767699)


Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 19 - 172
Target Start/End: Complemental strand, 46767699 - 46767547
Alignment:
19 aaaatcttccttctatactaaaatacaggaacttttgtaaatggtctgcttttagaaacataaattatgagcttatagggtgcttaannnnnnnnnatca 118  Q
    ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||         ||||    
46767699 aaaatcttccttctatactaaaatacaagaacttttgtaaatgttctgcttttagaagcataaattatgagcttatagggtgcttaa-ttttttttatca 46767601  T
119 ataatatgatcatttaatttcatacgtattcatcttgcagtagcttacttggag 172  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||    
46767600 ataatatgatcatttaatttcatacgtattcaccttgcagtagcttacttggag 46767547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University