View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17640_low_28 (Length: 347)
Name: NF17640_low_28
Description: NF17640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17640_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 35803643 - 35803389
Alignment:
| Q |
1 |
taaacttgattgtgatctctaattaatgaggggttcatagtctctacatttaaatacttatttaattgatatacaccgctaaatgtnnnnnnnnnnnnnc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
35803643 |
taaacttgattgtgatctctaattaatgaggggttcatagtctctacatttaaatacttatttaattgatatacaccgc-aaatgtaaaaagtcaaaaac |
35803545 |
T |
|
| Q |
101 |
atttaactttaatcataacaatttataaagtcacacgaatgattggttgtgaagcgtagacaacataaaacttttttacatcaatagggatagaagaaca |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35803544 |
atttaactttaatcataaccatttataaagtcacacgtatgattggttgtgaagcgtagacaacataaaacttttttacatcaatagggatagaagaaca |
35803445 |
T |
|
| Q |
201 |
aaacaaactaacagtaaaataggtcacaaagtaggagcacattaattgatttggat |
256 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35803444 |
aaacaaattaacagtaaaataggtcacaaagtaggagcacattaattgatttggat |
35803389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University