View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17640_low_34 (Length: 296)
Name: NF17640_low_34
Description: NF17640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17640_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 11 - 280
Target Start/End: Original strand, 23205690 - 23205956
Alignment:
| Q |
11 |
cagagacgagttttgtcacgtgagtctggtccgattttgattaaccaaggggggtggttgtgttggttttggggaggtgtgattagtaagatagatcgtt |
110 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | | ||| | || ||| ||||||||||||||||||||||||| |
|
|
| T |
23205690 |
cagagacgagttttatcacgtgagtctggtccgattttgattaaccaaggggggtg-tagggtttgatt--gggtggtgtgattagtaagatagatcgtt |
23205786 |
T |
|
| Q |
111 |
tggtgagagggaaggtgttattgttggacgtgttgttggaaggaaatgggaattttgaaggtaaatttaggaaaggttttttgggaatggaagaatgcca |
210 |
Q |
| |
|
||| |||||||||||||||| ||||||| ||||||||||||||||||||||| || |||||||||| |||| ||||||||||||||||||||| ||||| |
|
|
| T |
23205787 |
tggagagagggaaggtgttagtgttggaagtgttgttggaaggaaatgggaaattggaaggtaaatcaaggagaggttttttgggaatggaagagtgcca |
23205886 |
T |
|
| Q |
211 |
tgatgaacaaacggaacgaaagcggagttgatataattcactgtcgagcttttcggagatgagttgtaag |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
23205887 |
tgatgaacaaacggaacgaaagcggagttggtataattcgctgtcgagcttttcggaaatgagttgtaag |
23205956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 258
Target Start/End: Complemental strand, 9485153 - 9485083
Alignment:
| Q |
188 |
tttttgggaatggaagaatgccatgatgaacaaacggaacgaaagcggagttgatataattcactgtcgag |
258 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| || || |||||||| || ||||| |||||||| |
|
|
| T |
9485153 |
tttttgggaacggaagagcgccatgatgaacaaacggatcggaaacggagttggtagaattcgctgtcgag |
9485083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 11 - 61
Target Start/End: Complemental strand, 9485369 - 9485319
Alignment:
| Q |
11 |
cagagacgagttttgtcacgtgagtctggtccgattttgattaaccaaggg |
61 |
Q |
| |
|
|||||||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
9485369 |
cagagacgagttcggtcacgtgagtcaggaccgattttgattaaccaaggg |
9485319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University