View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17640_low_51 (Length: 237)
Name: NF17640_low_51
Description: NF17640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17640_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 9493620 - 9493402
Alignment:
| Q |
1 |
ggatgttacattaagatttgaaaggagttttggaagacatccatttgggtatgttacatgaattgtttgagacttgtaatcaattttgttgacaataaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9493620 |
ggatgttacattaagatttgaaaggagttttggaagacatccatttgggtatgttacatgaattgtttgagacttgtaatcaattttgttgacaataaaa |
9493521 |
T |
 |
| Q |
101 |
ttgattgaatttggcaattttagtatggtttgttgattctcattgcatgaaagatcatacccaattttgccacaattttgtggttgaatgttttggagtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9493520 |
ttgattgaatttggcaattttagtatggtttgttgattctcatagcatgaaagatcatacccaattttgccacaattttgtggttgaatgttttggagtc |
9493421 |
T |
 |
| Q |
201 |
taaaagggtattgaatagt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
9493420 |
taaaagggtattgaatagt |
9493402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University