View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17642_high_4 (Length: 279)

Name: NF17642_high_4
Description: NF17642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17642_high_4
NF17642_high_4
[»] chr4 (1 HSPs)
chr4 (161-262)||(12201928-12202029)


Alignment Details
Target: chr4 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 161 - 262
Target Start/End: Original strand, 12201928 - 12202029
Alignment:
161 agggtatcaacaactatagtcacagacaagacaatgtgactcaattcactgattgaaaatttcacgaatacataaagaatctgaagatcaaacaacactt 260  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
12201928 agggtatcaacaactatagtcacagacaagacaatgtgactcaattcactgattgaaaatttcgcgaatacataaagaatctgaagatcaaacaacactt 12202027  T
261 ca 262  Q
    ||    
12202028 ca 12202029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University