View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17642_high_6 (Length: 236)
Name: NF17642_high_6
Description: NF17642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17642_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 5 - 220
Target Start/End: Complemental strand, 38124741 - 38124526
Alignment:
| Q |
5 |
ggtgtggcgagaaatgtttgcattcacaatttgtgctctagcgtttgcatatcgccactgaatcaaacggttatcaagcaaacgaagcttatgaacgtct |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38124741 |
ggtgtggcgagaaatgtttgcattcacaatttgtgctctagcgtttgcatatcgccactgaatcaaacggttatcaagcaaacgaagcttatgaacgtct |
38124642 |
T |
|
| Q |
105 |
tcattatttccaaaaccattcgacggtgaattaaggccaacagattttttactcttgaagaaatcaaaaccaaaattgagtagtttttcaactcgttttg |
204 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38124641 |
tcattgtttccaaaaccattcgacggtgaattaaggccaacagattttttactcttgaagaaatcaaaaccaaaattgagtagtttttcaactcgttttg |
38124542 |
T |
|
| Q |
205 |
ccttcgtggggctcga |
220 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38124541 |
ccttcgtggggctcga |
38124526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University