View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17642_low_5 (Length: 279)
Name: NF17642_low_5
Description: NF17642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17642_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 161 - 262
Target Start/End: Original strand, 12201928 - 12202029
Alignment:
| Q |
161 |
agggtatcaacaactatagtcacagacaagacaatgtgactcaattcactgattgaaaatttcacgaatacataaagaatctgaagatcaaacaacactt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12201928 |
agggtatcaacaactatagtcacagacaagacaatgtgactcaattcactgattgaaaatttcgcgaatacataaagaatctgaagatcaaacaacactt |
12202027 |
T |
|
| Q |
261 |
ca |
262 |
Q |
| |
|
|| |
|
|
| T |
12202028 |
ca |
12202029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University