View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17642_low_8 (Length: 236)

Name: NF17642_low_8
Description: NF17642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17642_low_8
NF17642_low_8
[»] chr2 (1 HSPs)
chr2 (5-220)||(38124526-38124741)


Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 5 - 220
Target Start/End: Complemental strand, 38124741 - 38124526
Alignment:
5 ggtgtggcgagaaatgtttgcattcacaatttgtgctctagcgtttgcatatcgccactgaatcaaacggttatcaagcaaacgaagcttatgaacgtct 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38124741 ggtgtggcgagaaatgtttgcattcacaatttgtgctctagcgtttgcatatcgccactgaatcaaacggttatcaagcaaacgaagcttatgaacgtct 38124642  T
105 tcattatttccaaaaccattcgacggtgaattaaggccaacagattttttactcttgaagaaatcaaaaccaaaattgagtagtttttcaactcgttttg 204  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38124641 tcattgtttccaaaaccattcgacggtgaattaaggccaacagattttttactcttgaagaaatcaaaaccaaaattgagtagtttttcaactcgttttg 38124542  T
205 ccttcgtggggctcga 220  Q
    ||||||||||||||||    
38124541 ccttcgtggggctcga 38124526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University