View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17643_low_4 (Length: 264)
Name: NF17643_low_4
Description: NF17643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17643_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 30645303 - 30645545
Alignment:
| Q |
1 |
ttagacaacggaagctcactctcctccatcaaagccgcaaccacaacgtttctcgaacccccacattgcttaaggtcaatcacaactttctgagccaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30645303 |
ttagacaacggaagctcactctcctccatcaaagccgcaaccacaacgtttctcgaacccccacattgcttaaggtcaatcacaactttctgagccaaaa |
30645402 |
T |
 |
| Q |
101 |
cccctctgtaataagcaaacaacccttcaagctctttttctagggtttcgatttgtgcttgtttctcttcgggagtccgcgaattaacttccttttttcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30645403 |
cccctctgtaataagcaaacaacccttcaagctctttctctagggtttcgatttgtgcttgtttctcttcgggagtccgcgaattaacttccttttttcg |
30645502 |
T |
 |
| Q |
201 |
ctttcgagggttggatttggggcgatttggtgttggatcttga |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30645503 |
ctttcgagggttggatttggggcgatttggtgttggatcttga |
30645545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University