View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17644_low_11 (Length: 249)
Name: NF17644_low_11
Description: NF17644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17644_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 62 - 226
Target Start/End: Complemental strand, 34072889 - 34072725
Alignment:
| Q |
62 |
gtacttagatcataaacataatgcaaagtgttagaagaaagagaaagaagtacaaaccaagaagcataagcaaaactgatgaaacgacaaagatgaagca |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34072889 |
gtacttagatcataaacataatgcaaagtgttagaagaaagagaaagaagtacaaaccaagaagcataagcaaaactgatgaaacaacaaagatgaagca |
34072790 |
T |
|
| Q |
162 |
aaaccctcttgccattgttctctctatctctagattctcactgctctggtacttgttcttgttct |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34072789 |
aaaccctcttgccattgttctctctatctctagattctcactgctctggtacttgttcttgttct |
34072725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University