View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17645_low_9 (Length: 245)
Name: NF17645_low_9
Description: NF17645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17645_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 4520700 - 4520488
Alignment:
| Q |
12 |
gagtagcaaagggagaaggagacttttaatttcttcaattttcttcgtgccttccttgctagtcattgttcccttttattgaaggttaagagaatattcc |
111 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4520700 |
gagtaccaaaggaagaaggagacttttaatttcttcagttttcttcgtgccttccttgctagtcattgttcccttttattgaaggttaagagaatattcc |
4520601 |
T |
 |
| Q |
112 |
catctgcaagacgtagaaggcatcnnnnnnnatgcagaaatccccatctgtccaacaactcatatcgaatggggaggtggtgttcatactaaactgtatt |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4520600 |
catctgcaagacgtagaaggcatccggggggatgcagaaatccccatctgtccaacaactcatatcgaatggggaggtggtgttcatactaaactgtatt |
4520501 |
T |
 |
| Q |
212 |
tgtgcacaacttt |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4520500 |
tgtgcacaacttt |
4520488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University