View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17646_high_3 (Length: 206)
Name: NF17646_high_3
Description: NF17646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17646_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 46417418 - 46417231
Alignment:
| Q |
1 |
acagaagctgagctccgctcttatgaagacacaggctactatgctatgtataatacattagcgaaatgaaatgtagtattaattgacatgtacattgcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46417418 |
acagaagctgagctccgctcttatgaagacacaagctactatgctatgtataatacattagcgaaatgaaatgtaatattaattgacatgtacattgcac |
46417319 |
T |
|
| Q |
101 |
actaataacactgcaagtgtattattatttccatttctagatttgtactttgatctctgcccccaccctaagttacaatgtggaaagg |
188 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46417318 |
actaataacactacaagtatattattatttgcatttctagatttgtactttgatctctgcccccaccctaagttacaatgtggaaagg |
46417231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University