View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17647_high_14 (Length: 409)
Name: NF17647_high_14
Description: NF17647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17647_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 20 - 398
Target Start/End: Original strand, 49087445 - 49087823
Alignment:
| Q |
20 |
cggacgtgcttttgccacattcctcaccatctttctcctactaatcggtgtcactctacttgttctctggcttgtctaccgtccacacaaaccccacttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49087445 |
cggacgtgcttttgccacattcctcaccatctttctcctactaatcggtgtcactctacttgttctctggcttgtctaccgtccacacaaaccccacttc |
49087544 |
T |
 |
| Q |
120 |
acggttgtcggtgctgccatctatggcttcaacacaacctcaccaccgctcctttccgccaccttgcagttcaacatcctcattaagaacccaaacaagc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49087545 |
acggttgtcggtgctgccatctatggcttcaacacaacctcaccaccgctcctttccgccaccttgcagttcaacatcctcattaagaacccaaacaagc |
49087644 |
T |
 |
| Q |
220 |
gtgtctctgcttactatgacaggttctctgcttttgtgtcctataggaaccaagccataacaccgcaggttatgcttccgccgctgttcctggagaagca |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49087645 |
gtgtctctgcttactatgacaggttctctgcttttgtgtcctataggaaccaagccataacaccgcaggttatgcttccgccgctgttcctggagaagca |
49087744 |
T |
 |
| Q |
320 |
cagtcaggtgtccttgtcacccgtgataggaggcacggctgtgccagtgtcggtggaagtgtcgaatgggttgatgatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49087745 |
cagtcaggtgtccttgtcacccgtgataggaggcacggctgtgccagtgtcggtggaagtgtcgaatgggttgatgatg |
49087823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University