View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17647_high_22 (Length: 339)
Name: NF17647_high_22
Description: NF17647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17647_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 19 - 107
Target Start/End: Complemental strand, 4907498 - 4907411
Alignment:
| Q |
19 |
tgaagccagtttctaatttgggaggatgatttgtttggacacaaggatttgaatactctatttaagcgcacacgtttgagagaaggctg |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
4907498 |
tgaagccagtttctaatt-gggaggatgatttgtttggtcacaaggatttgaatactttatttaaacgcacacgtttgagagaaggctg |
4907411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 173 - 227
Target Start/End: Complemental strand, 4906954 - 4906900
Alignment:
| Q |
173 |
tgtgtccaaatacttgttgcaatcaaataatatgcaatttttaaaaaagtaagta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4906954 |
tgtgtccaaatacttgttgcaatcaaataatatgcaatttaaaaaaaagtaagta |
4906900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University