View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17647_high_29 (Length: 295)
Name: NF17647_high_29
Description: NF17647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17647_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 37 - 277
Target Start/End: Complemental strand, 37447094 - 37446853
Alignment:
| Q |
37 |
gttgtgctttattgcaaagctatgcattgttggtctcgtactcaaattaatcatgtcaaagtaaaatttatcatgtcgcgatgatatagataaatgaaat |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37447094 |
gttgtgctttattgcaaagctatgcattgttggtctcgtactcaaattaatcatgtcaaagtaaaatttatcatgtcgcgatgatatagataaatgaaat |
37446995 |
T |
|
| Q |
137 |
tttacaaataatgtaaataatatttatttgacaaacaagtatatgtgtaccattatttcct-nnnnnnnnnntgtataagtgtgccactataaatataaa |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37446994 |
tttacaaataatgtaaataatatttatttgacaaacaagtatatgtgtaccattatttcctaaaaaaaaaaatgtataagtgtgccactataaatataaa |
37446895 |
T |
|
| Q |
236 |
gtatctgctatgtcaatgttacaatatttgtggtgtagtttt |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37446894 |
gtatctgctatgtcaatgttacaatatttgtggtgcagtttt |
37446853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University