View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17647_high_33 (Length: 283)
Name: NF17647_high_33
Description: NF17647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17647_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 6 - 274
Target Start/End: Complemental strand, 41520943 - 41520674
Alignment:
| Q |
6 |
aaattatctttataacacaatagcaaattttatgtctatcaaacgtttatcatatatttaaaagatttgattatgcatcgatcaaccgtgttagcatata |
105 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||| || |||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
41520943 |
aaatgatctttataacacaataacaaattttatgtctattaatcgtttatcatatatttaaaagatttgattatgtattgatcaaccgtgttagcatata |
41520844 |
T |
 |
| Q |
106 |
ctgatttttgttttatatggctataatttcaaaccaagttatgactttttgtcaaaaactaatcaagtcacattgtattattaaatccataactgtaagt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41520843 |
ctgatttttgttttatatggctataatttcaaaccaagttatgactttttgtcaaaaactaatcaagtcacattgtattattaaatccataactgtaagt |
41520744 |
T |
 |
| Q |
206 |
accgtactatcaattatttttaacttctatttgttaatatatctctatggtctc-tttcttttcattcat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41520743 |
accgtactatcaattatttttaacttctatttgttaatatatctctatggtctcttttcttttcattcat |
41520674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University