View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17647_high_45 (Length: 211)
Name: NF17647_high_45
Description: NF17647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17647_high_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 7 - 193
Target Start/End: Complemental strand, 5650234 - 5650048
Alignment:
| Q |
7 |
gagtagcaaaggtatcattattcaccaacatttctcttaatacccatcctctnnnnnnnntactcttaataatattaatagtcatgttcttctcgaaaaa |
106 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5650234 |
gagtaacaagggtatcattattcaccaacatttctcttaatacccatcctctgaaaaaaatactcttactaatattaatagtcatgttcttctcgaaaaa |
5650135 |
T |
 |
| Q |
107 |
gctgcatagcattgtgtgtagaaaatggtagtatattaaaaatgaatgtgtgaaattgtaaaaggttggaatcttttatggaaaata |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5650134 |
gctgcatagcattgtgtgtagaaaatggtagtatattaaaaatgaatgtgtgaaattgtaaaaggttagaatcttttatggaaaata |
5650048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University