View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17647_low_24 (Length: 324)
Name: NF17647_low_24
Description: NF17647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17647_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 43475452 - 43475724
Alignment:
| Q |
1 |
ccaaaggaagcaatgaagaatgcctacatccacatgtaaacaattctgacatggagcaacaatcagagacagatcatcctgcaaatgatcatgtacctcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43475452 |
ccaaaggaagcaatgaagaatgcctacatccacatgtaaacaattctgacatggagcaacaatcagagacagatcatcctgcaaatgatcatgtacctcc |
43475551 |
T |
|
| Q |
101 |
ttttagttctactacagttgaatttgcatcatgtgaggttactgttggagtttagaatcatatcataactatgttagagtagggatctatgttattaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43475552 |
ttttagttctactacagttgaatttgcatcatgtgaggttactgttggagtttagaatcatatcataactatgttagagtagggatctatgttattaaat |
43475651 |
T |
|
| Q |
201 |
aagtatttagtagctattattgttgttgtgaatatagaatttggtttcatcataaacgtgtattgcaagtaag |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43475652 |
aagtatttagtagctattattgttgttgtgaatatagaatttggtttcatcataaacgtgtattgcaagtaag |
43475724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 324
Target Start/End: Original strand, 43475764 - 43475793
Alignment:
| Q |
295 |
gagttgcccttttgtgatatccgtttaaaa |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43475764 |
gagttgcccttttgtgatatccgtttaaaa |
43475793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University