View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17647_low_38 (Length: 256)
Name: NF17647_low_38
Description: NF17647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17647_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 36362982 - 36362751
Alignment:
| Q |
1 |
acagaactaaaacagaaccatgatgctagtactctactacacctcttgatgagtgtgaatcttgtgaccgggctttaaattccattccattccattcaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36362982 |
acagaactaaaacagaaccatgatgctagtactctactacacctcttgatgagtgtgaatcttgtgaccgggctttaaattccattccattccattcaca |
36362883 |
T |
|
| Q |
101 |
tggttctgtttggtagcattaaatatgcaatttaagacagtatgctttatatttttgacaaaggtaaagtgcatcatgagacataaatttactgccaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36362882 |
tggttctgtttggtagcattaaatatgcaatttaagacagtatgctttatatttttgacaaaggtaaagtgcatcatgagacataaatttactgccaaag |
36362783 |
T |
|
| Q |
201 |
agataaaaaattaccagaattaccgatttggt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36362782 |
agataaaaaattaccagaattaccgatttggt |
36362751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University