View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17647_low_42 (Length: 237)
Name: NF17647_low_42
Description: NF17647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17647_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 11 - 214
Target Start/End: Complemental strand, 32503070 - 32502867
Alignment:
| Q |
11 |
ttattctaatcttatgcataaaataagtagggagctagttttcaacatcttgcatttaggnnnnnnnntaatgtatagttttgaaagtgtcctttgacat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32503070 |
ttattctaatcttatgcataaaataagtagggagctagttttcaacatcttgcatttaggaaaaaaaataatgtatagttttgaaagtgtcctttgacat |
32502971 |
T |
 |
| Q |
111 |
tatttatccgaaagtatgtttatggagggtaaaagtttgtgttttttcttgcttgtattgtttgtacgtcggagattggattccagatgtataaaaattt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
32502970 |
tatttatccgaaagtatgtttatggagggtaaaagtttgtgttttttcttgcttgtattatttgtacatcggagattggattccagacgtataaaaattt |
32502871 |
T |
 |
| Q |
211 |
ctta |
214 |
Q |
| |
|
|||| |
|
|
| T |
32502870 |
ctta |
32502867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University