View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17647_low_45 (Length: 231)
Name: NF17647_low_45
Description: NF17647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17647_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 193
Target Start/End: Original strand, 23875960 - 23876135
Alignment:
| Q |
18 |
aaatcaatatcatatcttagtttcagaaacgtcaaagggaggctttgagggacttggtgttgcatcagacagtgactgcagtagtggaaattgtgaaagc |
117 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23875960 |
aaatcaatatcatatcttggttccagaaacgtcaaagggaggctttgaaggacttggtgttgcgtcagacagtgactgcagtagtggaaattgtgaaaga |
23876059 |
T |
 |
| Q |
118 |
gaactacttggcaagtgttgatattattattcaatttagccacttgttggtaaaacattttcatacatattaaccg |
193 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23876060 |
gagctacttggcaagtgttgatattattattcaatttagccacctgttggtaaaacattttcatacatattaaccg |
23876135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University