View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17647_low_47 (Length: 215)
Name: NF17647_low_47
Description: NF17647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17647_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 15359293 - 15359494
Alignment:
| Q |
1 |
acaattattgtgacaataataaatacataaatgcaggtggatttcatggtatacgagggtcaaagtttgtccaacattttacatcgatttgatgaatctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15359293 |
acaattattgtgacaataataaatacataaatgcaggtggatttcatggtatacgagggtcaaagtttgtccaacattttacatcgatttgatgaatctg |
15359392 |
T |
|
| Q |
101 |
atttaggaatatcacaattcgagggactaagaatggatggatctgaggtaattgatgaagataacaaccacattggcccaagttcttctaattactccat |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15359393 |
acttaggaatatcacaattcgagggactaagaatggatggatctgaggtaattgatgaagataacaaccacattggcccaagttcttctaattactccat |
15359492 |
T |
|
| Q |
201 |
ca |
202 |
Q |
| |
|
|| |
|
|
| T |
15359493 |
ca |
15359494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University