View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17647_low_49 (Length: 204)
Name: NF17647_low_49
Description: NF17647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17647_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 1326225 - 1326052
Alignment:
| Q |
18 |
acccttgatgaatttgaattttggtgatgaagtgcatgattgtaaattcttgaaagttgagcaataatctagtttatcaagtgctacaatcttgtagcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1326225 |
acccttgatgaatttgaattttggtgatgaagtgcatgattgtaaattcttgaaagttgagcaataatctagtttatcaagtgctacaatcttgtagcta |
1326126 |
T |
|
| Q |
118 |
ggatacttgttaattatcctcgtggttacatgtgaagctatgaaaccagcagctccagttatcagaatattctt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1326125 |
ggatacttgttaattatcctcgtggttacatgtgaagctatgaaaccagcagctccagttatcagaatattctt |
1326052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University