View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17648_low_17 (Length: 291)
Name: NF17648_low_17
Description: NF17648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17648_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 4301597 - 4301323
Alignment:
| Q |
1 |
tgatttctcaactgatgatgcaatgaatggtctccaaactaatttaaccatgaaacacacccgttttgctatgatggaacccttcgttgtctcaagccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4301597 |
tgatttctcaactgatgatgcaatgaatggtctccaaactaatttaaccatgaaacacacccgttttgctatgatggagcccttcgttgtctcaagccca |
4301498 |
T |
|
| Q |
101 |
tatgatgccgtcgacgttggttgtggatgagccgccgccgcctgcatcttggtgtccagaggttctggtggcggtgagattgttgcggtaatattaaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4301497 |
tatgatgccgtcgacgttggttgtggatgagccgccgccgcctgcatcttggtgtccggaggttctggtggcggtgagattgttgcggtaatattaaaat |
4301398 |
T |
|
| Q |
201 |
tggaacaaggttgatttctgataccgtcttctgtataattagcctcgtgaatgttgtggctttcagctgaacctt |
275 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4301397 |
tggaacgaggttgatttctgataccgtcttctgtataattagcctcgtgaatgttgtggctttcagctgaacctt |
4301323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 242
Target Start/End: Original strand, 442638 - 442692
Alignment:
| Q |
188 |
gtaatattaaaattggaacaaggttgatttctgataccgtcttctgtataattag |
242 |
Q |
| |
|
|||||| |||||||||||| ||||||| | |||||||| |||||||||||||||| |
|
|
| T |
442638 |
gtaatactaaaattggaaccaggttgactcctgataccatcttctgtataattag |
442692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 33959138 - 33959167
Alignment:
| Q |
1 |
tgatttctcaactgatgatgcaatgaatgg |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33959138 |
tgatttctcaactgatgatgcaatgaatgg |
33959167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University