View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17648_low_20 (Length: 254)
Name: NF17648_low_20
Description: NF17648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17648_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 97 - 236
Target Start/End: Original strand, 43335147 - 43335285
Alignment:
| Q |
97 |
gaagcaaatcccaaattatgtaaagttagctattgtatatactatttgtaactataaatactttgaatatatgcatcatctcctgaagctaacgacataa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43335147 |
gaagcaaatcccaaattatgtaaagttagctattgtatatactatttgtaactataaatactttgaatatatgcatcatctcctgaagctaacgacataa |
43335246 |
T |
|
| Q |
197 |
ttttagttgagattaattaatttaatttgaatgggttaag |
236 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
43335247 |
ttttagttgagattagttaa-ttaatttgaatgggttaag |
43335285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 43335051 - 43335080
Alignment:
| Q |
1 |
aagactgaagaattagtggtaggaggcaga |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43335051 |
aagactgaagaattagtggtaggaggcaga |
43335080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University