View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17648_low_25 (Length: 218)

Name: NF17648_low_25
Description: NF17648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17648_low_25
NF17648_low_25
[»] chr5 (1 HSPs)
chr5 (14-201)||(7004870-7005057)


Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 14 - 201
Target Start/End: Complemental strand, 7005057 - 7004870
Alignment:
14 atgaacattaggaacccagggcagaattaacaccaatcaatttacagcagaaacgtgaagcagggaaccaatttggttctttcttctccagatcataaaa 113  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7005057 atgaacattaagaacccagggcagaattaacaccaatcaatttacagcagaaacgtgaagcagggaaccaatttggttctttcttctccagatcataaaa 7004958  T
114 atttaataaataaattcaaagaccccactaggtgaactaaattagttaaatcatacaagaaattaaaattaaaagaagaccaaaaacg 201  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7004957 atttaataaataaattcaaagatcccactaggtgaactaaattagttaaatcatacaagaaattaaaattaaaagaagaccaaaaacg 7004870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University