View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17649_high_41 (Length: 274)
Name: NF17649_high_41
Description: NF17649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17649_high_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 19 - 265
Target Start/End: Original strand, 18600645 - 18600891
Alignment:
| Q |
19 |
cattcagatatgatggaggcttgtggtggcccatcccaagcccatgagcctttgggaaacttacacacatcattaaatgatggtgtcgagtagcagccat |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18600645 |
cattcagatatgatggaggcctgtggtggcccatcccaagcccatgagcctttgggaaacttacacacatcattaaatgatggtgtcgagtagcagccat |
18600744 |
T |
 |
| Q |
119 |
tcaaaatgtcaatgttttcaccggtgcagtgccatgatggaactgcatcggtgaaaacagtgatgaatgtttgttgggcatcaaagatccaagcaaagga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18600745 |
tcaaaatgtcaatgttttcaccggtgcagtgccatgatggaacttcatcggtgaaaacagtgatgaatgtttgttgggcatcaaagatccaagcaaagga |
18600844 |
T |
 |
| Q |
219 |
tataagaacagcttgaaagaattgactccaattgagttcacctatgc |
265 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18600845 |
tataagaagagcttgaaagaattgactccaattgagttcacctatgc |
18600891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University