View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17649_high_66 (Length: 207)
Name: NF17649_high_66
Description: NF17649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17649_high_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 4155516 - 4155344
Alignment:
| Q |
18 |
aaaagaactaacagattttccattgccagttttggagcaatcaataggcattgtgcccaacccagtcatttggaagcaattaaaccattcattatgtcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4155516 |
aaaagaactaacagattttccattgccagttttggagcaatcaataggcattgtgcccaacccagtcatttggaagcaattaaaccattcattatgtcta |
4155417 |
T |
|
| Q |
118 |
ttctctaaggtgagacgttccaagcaacgtataaatttgaaatgctgtgcctgcatcatatttatggtcataa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4155416 |
ttctctaaggtgagacgttccaagcaacgtataaatttgaaatgctgtgcctgcatcatatttatggccataa |
4155344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 61 - 178
Target Start/End: Complemental strand, 4160636 - 4160519
Alignment:
| Q |
61 |
ataggcattgtgcccaacccagtcatttggaagcaattaaaccattcattatgtctattctctaaggtgagacgttccaagcaacgtataaatttgaaat |
160 |
Q |
| |
|
||||||| || |||||||||||||||| ||| |||||||||||||||||||| || | ||||| ||| |||| |||||||| |||||||| |||||| |
|
|
| T |
4160636 |
ataggcaatgcgcccaacccagtcattcggatgcaattaaaccattcattatatcgaccctctatggttagactctccaagcagtgtataaatctgaaat |
4160537 |
T |
|
| Q |
161 |
gctgtgcctgcatcatat |
178 |
Q |
| |
|
| ||| ||| |||||||| |
|
|
| T |
4160536 |
gatgttcctacatcatat |
4160519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University