View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17649_low_31 (Length: 326)
Name: NF17649_low_31
Description: NF17649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17649_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 7e-40; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 198 - 309
Target Start/End: Complemental strand, 26913885 - 26913774
Alignment:
| Q |
198 |
atatatatataccacataaaactcatacacaaccgtgataatcggcattcgaactccagtcatgattttcaacctaataagtttgtcggtttagctagac |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||| |||||| ||||||||||| || |
|
|
| T |
26913885 |
atatatatataccacataaaactcatacacaaccgtgataaccggcattcgaactccaatcataattttcaacctaacaagtttttcggtttagctgcac |
26913786 |
T |
 |
| Q |
298 |
tttacggatatg |
309 |
Q |
| |
|
|||||||||||| |
|
|
| T |
26913785 |
tttacggatatg |
26913774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 26914218 - 26914135
Alignment:
| Q |
1 |
tccaagttttgctgtattgtttgttaatgattgacatgtcttttgcatatgggagagaacaaagttcatatgatatgcccattc |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26914218 |
tccaagttttgctgtattgtttgttaatgattgacatgtcttttgcatatgggagagaacaaagttcatatgatatgcccattc |
26914135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 109 - 199
Target Start/End: Complemental strand, 26914137 - 26914047
Alignment:
| Q |
109 |
ttcgacatatggttacactgcttattgtatatgggagagaatgaagttcttgtgatgtcattctttctagcatatcaaacaaattactcat |
199 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26914137 |
ttcgaaatatggttacattgcttattgtatatgggagagaatgaagttcttgtgatgtcattctttctagcatatcaaacaaattactcat |
26914047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 202 - 306
Target Start/End: Complemental strand, 51181806 - 51181702
Alignment:
| Q |
202 |
atatataccacataaaactcatacacaaccgtgataatcggcattcgaactccagtcatgattttcaacctaataagtttgtcggtttagctagacttta |
301 |
Q |
| |
|
|||||| |||||||||| ||| ||||||||||||||| ||||||||||||||| |||||||||| |||||||||| |||||| ||||||||| |||||| |
|
|
| T |
51181806 |
atatatgccacataaaattcacacacaaccgtgataaccggcattcgaactcctgtcatgatttcaaacctaataaatttgtcagtttagctaaacttta |
51181707 |
T |
 |
| Q |
302 |
cggat |
306 |
Q |
| |
|
||||| |
|
|
| T |
51181706 |
cggat |
51181702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 51182019 - 51181955
Alignment:
| Q |
1 |
tccaagttttgctgtattgtttgttaatgattgacatgtcttttgcatatgggagagaacaaagttcat |
69 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51182019 |
tccaagttttgctgtattgtt----aatgattgacatgtcttttgcatatgggagaggacaaagttcat |
51181955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 122 - 187
Target Start/End: Complemental strand, 51181925 - 51181859
Alignment:
| Q |
122 |
tacactgcttattgtatatg-ggagagaatgaagttcttgtgatgtcattctttctagcatatcaaa |
187 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||| |||||||| ||| ||||||||| |
|
|
| T |
51181925 |
tacattgcttattgtatatttggagagaatgaagttcttgtgatttcattcttgctaacatatcaaa |
51181859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University