View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17649_low_32 (Length: 318)
Name: NF17649_low_32
Description: NF17649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17649_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 305
Target Start/End: Original strand, 27769132 - 27769419
Alignment:
| Q |
18 |
aacatgattgcgttttaaagccttaatctcttccatgaagtggcgcggttggtgagctaagaaacatcaaaagagtttaaagacggtgtggttcctaatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27769132 |
aacatgattgcgttttaaagccttaatctcttccacgaagtggcgcggttggtgagttaagaaacatcaaaagagtttaaagtcggtgtggttcctaatt |
27769231 |
T |
|
| Q |
118 |
cgatttttgatagtcggtacattagataaaaaattgtctcatggtttagtaaaagacgcaaatttctgtttttgtccgatgttttactacttgttttgtt |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27769232 |
cgatttttgatagtcgatacattagataaaaaattgtctcatggtttaataaaagacacaaatttctgtttttgtccggtgttttactacttgttttgtt |
27769331 |
T |
|
| Q |
218 |
cagtcccatgatcagattataaatcaaacaaagtacacaaaatacatgtttaatccaccgnnnnnnnagcatatccaacccaccctat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27769332 |
cagtcccatgatcagattataaatcaaacaaagtacacaaaatacatgtttaatccaccgtttttttagcatatccaacccaccctat |
27769419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 211 - 259
Target Start/End: Original strand, 33969165 - 33969213
Alignment:
| Q |
211 |
ttttgttcagtcccatgatcagattataaatcaaacaaagtacacaaaa |
259 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||||||| ||||| |||| |
|
|
| T |
33969165 |
ttttgtccagtcccatgatcagtttctaaatcaaacaatgtacaaaaaa |
33969213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University