View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17649_low_60 (Length: 240)
Name: NF17649_low_60
Description: NF17649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17649_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 40009237 - 40009442
Alignment:
| Q |
17 |
aatatctactccaactactgcaacgtaaattagtaattggtttcttgtatagattcttcatcctcatttttctcaagctctactctatatgttcaaaata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40009237 |
aatatctactccaactactgcaacgtaaattagtaattggtttcttgtatagattcttcatcctcatttttctcaagctctactctatatgttcaaaata |
40009336 |
T |
 |
| Q |
117 |
atgatgaaaattgtaagtaatgaatgtaagcaaagctatatgtgtagcgtatacttgattgaaaaatgaaataatcattagaagacacactcacctggaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40009337 |
atgatgaaaattgtaagtaatgaatgtaagcaaagctatatgtgtagcgtatacttgattgaaaaatgaaataatcattagaagacacactcacctggaa |
40009436 |
T |
 |
| Q |
217 |
ctatat |
222 |
Q |
| |
|
|||||| |
|
|
| T |
40009437 |
ctatat |
40009442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University