View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17649_low_62 (Length: 227)

Name: NF17649_low_62
Description: NF17649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17649_low_62
NF17649_low_62
[»] chr8 (1 HSPs)
chr8 (1-96)||(42876553-42876650)


Alignment Details
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 42876650 - 42876553
Alignment:
1 tgatttaagaggaaataaaattgcaataatttctttaccnnnnnnnnnn--ttgcaataacttatacgatatttttccaataagttcgcaatcgtggc 96  Q
    ||||||||||||||||||||||||||||||||||| |||            ||||||||||||| |||||||||||||||||||||||||||||||||    
42876650 tgatttaagaggaaataaaattgcaataatttcttgaccaaaaaaaagaaattgcaataacttacacgatatttttccaataagttcgcaatcgtggc 42876553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University