View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17649_low_62 (Length: 227)
Name: NF17649_low_62
Description: NF17649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17649_low_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 42876650 - 42876553
Alignment:
| Q |
1 |
tgatttaagaggaaataaaattgcaataatttctttaccnnnnnnnnnn--ttgcaataacttatacgatatttttccaataagttcgcaatcgtggc |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42876650 |
tgatttaagaggaaataaaattgcaataatttcttgaccaaaaaaaagaaattgcaataacttacacgatatttttccaataagttcgcaatcgtggc |
42876553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University